Protein expression/secretion boost by a novel unique 21-mer cis-regulatory motif (Exin21) via mRNA stabilization.

Boosting protein production is invaluable in both industrial and academic applications. We discovered a novel expression-increasing 21-mer cis-regulatory motif (Exin21) that inserts between SARS-CoV-2 envelope (E) protein-encoding sequence and luciferase reporter gene. This unique Exin21 (CAACCGCGGTTCGCGGCCGCT), encoding a heptapeptide (QPRFAAA, designated as Qα), significantly (34-fold on average) boosted E production. Both synonymous and nonsynonymous mutations within Exin21 diminished its boosting capability, indicating the exclusive composition and order of 21 nucleotides. Further investigations demonstrated that Exin21/Qα addition could boost the production of multiple SARS-CoV-2 structural proteins (S, M, and N) and accessory proteins (NSP2, NSP16, and ORF3), and host cellular gene products such as IL-2, IFN-γ, ACE2, and NIBP. Exin21/Qα enhanced the packaging yield of S-containing pseudoviruses and standard lentivirus. Exin21/Qα addition on the heavy and light chains of human anti-SARS-CoV monoclonal antibody robustly increased antibody production. The extent of such boosting varied with protein types, cellular density/function, transfection efficiency, reporter dosage, secretion signaling, and 2A-mediated auto-cleaving efficiency. Mechanistically, Exin21/Qα increased mRNA synthesis/stability, and facilitated protein expression and secretion. These findings indicate that Exin21/Qα has the potential to be used as a universal booster for protein production, which is of importance for biomedicine research and development of bioproducts, drugs, and vaccines.

RBM24 inhibits the translation of SARS-CoV-2 polyproteins by targeting the 5'-untranslated region.

SARS-CoV-2 is a betacoronavirus with single-stranded positive-sense RNA, which is a serious global threat to human health. Understanding the molecular mechanism of viral replication is crucial for the development of antiviral drugs. The synthesis of viral polyproteins is a crucial step in viral progression. The synthesis of viral polyproteins in coronaviruses is regulated by the 5'-untranslated region (UTR); however, the detailed regulatory mechanism needs further investigation. The present study demonstrated that the RNA binding protein, RBM24, interacts with the RNA genome of SARS-CoV-2 via its RNA recognition submotifs (RNPs). The findings revealed that RBM24 recognizes and binds to the GUGUG element at stem-loop 4 (SL4) in the 5'-UTR of SARS-CoV-2. The interaction between RBM24 and 5'-UTR prevents 80S ribosome assembly, which in turn inhibits polyproteins translation and the replication of SARS-CoV-2. Notably, other RNA viruses, including SARS-CoV, MERS-CoV, Ebolavirus, rhinovirus, West Nile virus, Zika virus, Japanese encephalitis virus, yellow fever virus, hepatitis C virus, and human immunodeficiency virus-1 also contain one or several G(U/C/A)GUG sequences in the 5'-UTR, which is also targeted by RBM24. In conclusion, the present study demonstrated that RBM24 functions by interacting with the 5'-UTR of SARS-CoV-2 RNA, and elucidated that RBM24 could be a host restriction factor for SARS-CoV-2 and other RNA viruses.

Comparison of BNT162b2-, mRNA-1273- and Ad26.COV2.S-Elicited IgG and Neutralizing Titers against SARS-CoV-2 and Its Variants.

Because the vaccine-elicited antibody and neutralizing activity against spike protein of SARS-CoV-2 are associated with protection from COVID-19, it is important to determine the levels of specific IgG and neutralization titers against SARS-CoV-2 elicited by the vaccines. While three widely used vaccine brands (Pfizer-BNT162b2, Moderna-mRNA-1273 and Johnson-Ad26.COV2.S) are effective in preventing SARS-CoV-2 infection and alleviating COVID-19 illness, they have different efficacy against COVID-19. It is unclear whether the differences are due to varying ability of the vaccines to elicit a specific IgG antibody response and neutralization activity against spike protein of the virus. In this study, we compared the plasma IgG and neutralization titers against spike proteins of wild-type SARS-CoV-2 and eight variants in healthy subjects who received the mRNA-1273, BNT162b2 or Ad26.COV2.S vaccine. We demonstrated that subjects vaccinated with Ad26.COV2.S vaccine had significantly lower levels of IgG and neutralizing titers as compared to those who received the mRNA vaccines. While the linear regression analysis showed a positive correlation between IgG levels and neutralizing activities against SARS-CoV-2 WT and the variants, there was an overall reduction in neutralizing titers against the variants in subjects across the three groups. These findings suggest that people who received one dose of Ad26.COV2.S vaccine have a more limited IgG response and lower neutralization activity against SARS-CoV-2 WT and its variants than recipients of the mRNA vaccines. Thus, monitoring the plasma or serum levels of anti-SARS-CoV-2 spike IgG titer and neutralization activity is necessary for the selection of suitable vaccines, vaccine dosage and regimens.

Treatment strategies for gastric cancer during the COVID-19 pandemic.

The coronavirus disease 2019 pandemic has become a major global public health problem. Governments are taking the necessary steps to reduce the movement of people to contain the spread of the virus. However, these measures have caused considerable distress to patients with gastric cancer who are newly diagnosed or are undergoing treatment. In addition to the cancer, they must deal with longer waiting times for surgery and poor communication with doctors. Furthermore, gastric cancer patients generally have low immunity and a poor nutritional status, so they are a high-risk group for infection with the novel coronavirus. Therefore, it is necessary to formulate reasonable outpatient management strategies to reduce the adverse effects of the pandemic on their treatment. We summarize the management strategies for patients with gastric cancer during the pandemic.

TLR7 Activation of Macrophages by Imiquimod Inhibits HIV Infection through Modulation of Viral Entry Cellular Factors.

The Toll-like receptor (TLR) 7 is a viral sensor for detecting single-stranded ribonucleic acid (ssRNA), the activation of which can induce intracellular innate immunity against viral infections. Imiquimod, a synthetic ligand for TLR7, has been successfully used for the topical treatment of genital/perianal warts in immunocompetent individuals. We studied the effect of imiquimod on the human immunodeficiency virus (HIV) infection of primary human macrophages and demonstrated that the treatment of cells with imiquimod effectively inhibited infection with multiple strains (Bal, YU2, and Jago) of HIV. This anti-HIV activity of imiquimod was the most potent when macrophages were treated prior to infection. Infection of macrophages with pseudotyped HIV NL4-3-ΔEnv-eGFP-Bal showed that imiquimod could block the viral entry. Further mechanistic studies revealed that while imiquimod had little effect on the interferons (IFNs) expression, its treatment of macrophages resulted in the increased production of the CC chemokines (human macrophage inflammatory protein-1 alpha (MIP-1α), MIP-1ß, and upon activation regulated normal T cells expressed and secreted (RANTES)), the natural ligands of HIV entry co-receptor CCR5, and decreased the expression of CD4 and CCR5. The addition of the antibodies against the CC chemokines to macrophage cultures could block imiquimod-mediated HIV inhibition. These findings provide experimental evidence to support the notion that TLR7 participates in the intracellular immunity against HIV in macrophages, suggesting the further clinical evaluation of imiquimod for its additional benefit of treating genital/perianal warts in people infected with HIV.

Novel Scalable and Simplified System to Generate Microglia-Containing Cerebral Organoids From Human Induced Pluripotent Stem Cells.

Human cerebral organoid (CO) is a three-dimensional (3D) cell culture system that recapitulates the developing human brain. While CO has proved an invaluable tool for studying neurological disorders in a more clinically relevant matter, there have still been several shortcomings including CO variability and reproducibility as well as lack of or underrepresentation of certain cell types typically found in the brain. As the technology to generate COs has continued to improve, more efficient and streamlined protocols have addressed some of these issues. Here we present a novel scalable and simplified system to generate microglia-containing CO (MCO). We characterize the cell types and dynamic development of MCOs and validate that these MCOs harbor microglia, astrocytes, neurons, and neural stem/progenitor cells, maturing in a manner that reflects human brain development. We introduce a novel technique for the generation of embryoid bodies (EBs) directly from induced pluripotent stem cells (iPSCs) that involves simplified steps of transitioning directly from 3D cultures as well as orbital shaking culture in a standard 6-well culture plate. This allows for the generation of MCOs with an easy-to-use system that is affordable and accessible by any general lab.

Correlation of vaccine-elicited antibody levels and neutralizing activities against SARS-CoV-2 and its variants (preprint)

Both Pfizer-BNT162b2 and Moderna-mRNA-1273 vaccines can elicit an effective immune response against SARS-CoV-2 infection. However, the elicited serum antibody levels vary substantially and longitudinally decrease after vaccination. We examined the correlation of vaccination-induced IgG levels and neutralization titers against newly emerged variants remains and demonstrate a significant reduction of neutralization activities against the variants (B.1.1.7, B.1.525, and B.1.351) in Pfizer or Moderna vaccined sera. There was a significant and positive correlation between serum IgG levels and ID50 titers for not only SARS-CoV-2 WT but also the variants. These findings indicate that a high level of anti-spike IgG may offer better protection against infection from SARS-CoV-2 and its variants. Therefore, it is necessary to longitudinally monitor specific serum IgG level for evaluating the protective efficacy of the vaccines against SARS-CoV-2 and its new variants.

Genomic Elucidation of a COVID-19 Resurgence and Local Transmission of SARS-CoV-2 in Guangzhou, China.

While China experienced a peak and decline in coronavirus disease 2019 (COVID-19) cases at the start of 2020, regional outbreaks continuously emerged in subsequent months. Resurgences of COVID-19 have also been observed in many other countries. In Guangzhou, China, a small outbreak, involving less than 100 residents, emerged in March and April 2020, and comprehensive and near-real-time genomic surveillance of SARS-CoV-2 was conducted. When the numbers of confirmed cases among overseas travelers increased, public health measures were enhanced by shifting from self-quarantine to central quarantine and SARS-CoV-2 testing for all overseas travelers. In an analysis of 109 imported cases, we found diverse viral variants distributed in the global viral phylogeny, which were frequently shared within households but not among passengers on the same flight. In contrast to the viral diversity of imported cases, local transmission was predominately attributed to two specific variants imported from Africa, including local cases that reported no direct or indirect contact with imported cases. The introduction events of the virus were identified or deduced before the enhanced measures were taken. These results show the interventions were effective in containing the spread of SARS-CoV-2, and they rule out the possibility of cryptic transmission of viral variants from the first wave in January and February 2020. Our study provides evidence and emphasizes the importance of controls for overseas travelers in the context of the pandemic and exemplifies how viral genomic data can facilitate COVID-19 surveillance and inform public health mitigation strategies.